Skip to contents

Get sequence for genomic ranges and variants

Source: R/getRangeSeqs.R
getRangeSeqs.Rd

Query sequences associated with a given range in a reference genome and optionally include nucleotides up and downstream of the range of interest sequences. Store the results in the metadata of the range object.

Usage

getRangeSeqs(x, genome, up = 0, down = 0, refCol = NULL, altCol = NULL)

Arguments

x

A VRanges or GRanges object with one or more variants. seqnames and ranges fields are required.

genome

A BSgenome object for the genome build to use.

up

Numeric, number of bases to return upstream of variant

down

Numeric, number of bases to return downstream of variant

refCol

Column name in meta data storing the ref allele

altCol

Column name in meta data storing the alt allele

Value

a x with added meta data columns. By default, only a "sequence" column is added to the meta data. If variant information is supplied, either in a VRanges object or through the "allele" parameter, "ref_seq" and "alt_seq" columns are added to the meta data.

Examples

# set reference genome
b <- BSgenome.Hsapiens.UCSC.hg19::Hsapiens

# Query sequnece for a GRanges object
gr <- GenomicRanges::GRanges(
    seqnames = "chr12",
    ranges = IRanges::IRanges(94136009, 94136019)
)
getRangeSeqs(gr, genome = b)
#> GRanges object with 1 range and 1 metadata column:
#>       seqnames            ranges strand |    sequence
#>          <Rle>         <IRanges>  <Rle> | <character>
#>   [1]    chr12 94136009-94136019      * | GAGGCATCTGC
#>   -------
#>   seqinfo: 1 sequence from an unspecified genome; no seqlengths

# Query variant sequences for a VRanges object with 10bp flanks
vr <- VariantAnnotation::VRanges(
    seqnames = "chr12",
    ranges = IRanges::IRanges(94136009),
    ref = "G", alt = "C"
)
getRangeSeqs(vr, genome = b, up = 10, down = 10)
#> VRanges object with 1 range and 2 metadata columns:
#>       seqnames    ranges strand         ref              alt     totalDepth
#>          <Rle> <IRanges>  <Rle> <character> <characterOrRle> <integerOrRle>
#>   [1]    chr12  94136009      *           G                C           <NA>
#>             refDepth       altDepth   sampleNames softFilterMatrix |
#>       <integerOrRle> <integerOrRle> <factorOrRle>         <matrix> |
#>   [1]           <NA>           <NA>          <NA>                  |
#>                     ref_seq               alt_seq
#>                 <character>           <character>
#>   [1] AGAAGGCTTTGAGGCATCTGC AGAAGGCTTTCAGGCATCTGC
#>   -------
#>   seqinfo: 1 sequence from an unspecified genome; no seqlengths
#>   hardFilters: NULL